Database

Filter


Text Search

Genus Common Name Gene Region Fragment Length Forward Primer Reverse Primer Probe PCR Efficiency
Oncorhynchus Chinook salmon COIII/ND3 CCTTTCTAGCCGTTTGCCTTCT CAGCTTCAAAGCCAAAATGATGTTC 5’ FAMAGTGGTATTGAACTTGTCG–NFQ
Oplegnathus Striped knifejaw COI 166 GAAACTGACTCATCCCCCTCA CCTGCGAGAGGCGGAT FAM–TAACATGAGCTTTTGACTGCTCCCACCCTC–TAMRA 0.81–0.85
Pacifastacus Northamerican crayfish COI 65 AACTAGAGGAATAGTTGAAAG CCGCTGCTAGAGGAGGATAA FAM‐AGGAGTGGGTACTGGATGAACT‐BHQ1
Pelodiscus Chinese Softshell Turtle 16S 91 GCCCAGTGATAATATTYAACG GCCTTTCATACGAGTCCTT CGGTATCCTAACCGTGCAA 105.75
Platalea Eurasian spoonbill COI 160 CTATTCGTTTGATCAGTCCTAATCACTG AAAATAGATGTTGGTATAAGACAGGGTC 1.82
Platysternon Big–Headed Turtle ND4 83 GCAAACACAAACTATGAGCGAAC GTCCCCATTAGTGGCAGGAA CGAACATTATTAATTGCC 94.15
Procambarus Marbled Crayfish COI 189 GTATAGTTGAGAGGGGAGTA CCATAGTTATACCAGCTGCC AGGTATTTTTTCCTTGCA 86.82
Rana Columbia spotted frog Cytb TTCAATGAATCTGAGGAGGCTTTT GAAAGGAAGGATGAAGTGGAATGT 6FAM–AGTAGACAATGCTACCCTC–MGB
Recurvirostra COI 199 AGGGACCCTACTAGGAGATGACCAAATC TAGGAATGATGGTGGTAATAGTCAAAAG 1.97
Richardsonius redside shiner COI 62 5′–CTGGCTGCCGGAATTACAA–3′ 5′–GGGTCGAAGAATGTGGTGTTAA–3′ 6FAM–5′–ACTTCTCACAGACCGAAA–3′
Saccharina COI 92 5’‐TGCGGTGCCTACAGGT ‐3′ 5’‐CAATTGAGAATAGCATGGGGGT‐3′ 99.67
Salvelinus Brook trout Cytb TGGCCAACCTCCGAAAAAC AGGTCGACTAGTGCGTCATTAGC CCCACTCCTAAAAAT 99.79
Trachemys Red–Eared Slider 12S 70 TCGCCAGCYTACCCYGT CCTTGACCTGACTTGTTAATGG GGATACAAAAGTAAGCAAG 72.86
Trachurus Japanese jack mackerel Cytb 127 CAGATATCGCAACCGCCTTT CCGATGTGAAGGTAAATGCAAA FAM–CCGTAGCACACATCTGCCGGGA–TAMRA 0.88–0.92
Tringa COI 188 CCCGTATAAATAACATAAGCTTT AGAAGAGACACCTGCCAAATGGAGA 1.84
Undaria COI 235 5’‐ACGGTATACCCTCCGCTTAGT‐3′ 5’‐CACCTGCTAAAACCGGCAA‐3′ 109.68