bighead carp Details Genus:Hypophthalmichthys Species:nobilis Common Name:bighead carp Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status:invasive Gene Region:D-loop Fragment Length:312 qPCR Chemistry:Conventional PCR Forward Primer:TAACTTAAATAAACAGATTA Reverse Primer:TAAAAGAATGCTCGGCATGT Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:207 copies/μL Limit of Quantification:N/A Journal:Conservation Letters Source: https://doi.org/10.1111/j.1755-263X.2010.00158.x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast