Tiger mosquito 0 comments Details Genus:Aedes Species:albopictus Common Name:Tiger mosquito Genbank Taxid: Group:Insect Habitat:Freshwater Status:Invasive Gene Region:ITS-1 Fragment Length:35+17+19 qPCR Chemistry:Probe Forward Primer:GTCAGCAGGGCCGAACC Reverse Primer:GACGACCCGCCACTTAGCT Probe:CAGGGCACATACGTCCGCTTTGGTT PCR Efficiency:96.9 R2: Limit of Detection:0.72 fg/ul Limit of Quantification:2.11 fg/ul Journal:PLOS one Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5023106/ Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
