Details Genus:Alburnoides Species:bipunctatus Common Name: Genbank Taxid: Group:Fish Habitat:Freshwater Status:Thretened/Endangered Gene Region:CYTB Fragment Length:63 qPCR Chemistry:Probe Forward Primer:GGGCGCCACCGTCAT Reverse Primer:TGAACAAGTATGTCTCCCATGTAAGG Probe:CGA ATC TCC TTT CAG CAG T PCR Efficiency:93 R2: Limit of Detection:40.310 ct Limit of Quantification:38.042 ct Journal:Conservation Genetics Resources Source: https://link.springer.com/article/10.1007%2Fs12686-018-1063-7 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast