Unisexual mole sala- mander complex 0 comments Details Genus:Ambystoma Species:unisexual Common Name:Unisexual mole sala- mander complex Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:91 qPCR Chemistry:Probe Forward Primer:CTGAGCTGGGATAGTTGGAACC Reverse Primer:ATAGATTTGGTCGTC GCCTAGCTGGAACC Probe:CGAGCAGAATTAAGCCTGGAACC PCR Efficiency:102.03 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0962-3 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
