Eastern American toad 0 comments Details Genus:Anaxyrus Species:americanus Common Name:Eastern American toad Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:86 qPCR Chemistry:Probe Forward Primer:GCAGGACCATCAGTTGACTTAACC Reverse Primer:GTGGTAATAAAATTA ATTGCCCCAAG GACTTAACC Probe:ACACCTGCTAGATGG AGGGACTTAACC PCR Efficiency:96.01 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0962-3 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
