Coastal tailed frog Details Genus:Ascaphus Species:truei Common Name:Coastal tailed frog Genbank Taxid: Group:Amphibian Habitat:freshwater Status:endangered/threatened Gene Region:CYTB Fragment Length:202 qPCR Chemistry:Probe Forward Primer:GAACATTGGCATTATCCTACTT Reverse Primer:AGGCGAAAAATCGTGTTAAC Probe:CGCTTTTGTAGGGTATGTGTTACCG PCR Efficiency:N/A R2: Limit of Detection:0.16 copies/reaction Limit of Quantification:20 copies/reaction Journal:PLOS One Source: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0213849 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast