narrow-clawed crayfish 0 comments Details Genus:Astacus Species:leptodactylus Common Name:narrow-clawed crayfish Genbank Taxid: Group:Crustacean Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:65 qPCR Chemistry:Probe Forward Primer:AACTAGAGGTATAGTAGAGGG Reverse Primer:CTGATGCTAGGGGAGGATAA Probe:Fam-GGGTGTAGGAACTGGATGAACC-BHQ-1 PCR Efficiency:88.78 R2: Limit of Detection:5/PCR Limit of Quantification:5/PCR or 10/PCR dependent on approach Journal:PLOS One Source: https://doi.org/10.1371/journal.pone.0179261 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
