Details Genus:Corbula Species:amurensis Common Name: Genbank Taxid: Group:Mollusc Habitat:Marine Status:Invasive Gene Region:18S Fragment Length:107 qPCR Chemistry:Probe Forward Primer:GACCTCACGGGAAGAGCG Reverse Primer:GCTAGGGCCGTGCGAT Probe:CGCTCACTGTGGTGACTCTGGA PCR Efficiency:99 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Journal of Experimental Marine Biology and Ecology Source: https://www.sciencedirect.com/science/article/pii/S0022098111004667 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast