Slimy sculpin Details Genus:Cottus Species: Common Name:Slimy sculpin Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:CYTB Fragment Length:118 qPCR Chemistry:Probe Forward Primer:GGAGGCGTCCTAGCCCTC Reverse Primer:GAGTCCAAAATAGGAATTGGGTCAC Probe:CATCCATCCTGGTGCTCAT PCR Efficiency:91 R2: Limit of Detection:5 copies per reaction Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://link.springer.com/article/10.1007/s12686-017-0883-1 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast