grass carp Details Genus:Ctenopharyngodon Species:idella Common Name:grass carp Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status:invasive Gene Region:CYTB Fragment Length:61 qPCR Chemistry:Probe Forward Primer:CAACGACGCGCTAGTCGAT Reverse Primer:TCCAAAGTTTCATCATGCAGAGA Probe:TTCCCACACCATCTAA PCR Efficiency:N/A R2: Limit of Detection:0.015 copies/μl Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://doi.org/10.1111/1755-0998.12619 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast