common carp Details Genus:Cyprinus Species:carpio Common Name:common carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:D-loop Fragment Length:146 qPCR Chemistry:Dye Forward Primer:GAGTGCAGGCTCAAATGTTAAA Reverse Primer:GTAAGGATAAGTTGAACTAGAGACAG Probe:N/A PCR Efficiency:81-97 R2: Limit of Detection:30 copies /reaction Limit of Quantification:N/A Journal:Methods in Ecology and Evolution Source: https://besjournals.onlinelibrary.wiley.com/doi/full/10.1111/2041-210X.12206 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast