0 comments Details Genus:Dactylogyrus Species:vastator Common Name: Genbank Taxid: Group:parasite Habitat:Freshwater Status:Parasite Gene Region:ITS-1 Fragment Length:210 qPCR Chemistry:Dye Forward Primer:GTTGCGGAACTGAACCCTAGCCA Reverse Primer:AGACTGCACGACACGTTACCAA Probe:N/A PCR Efficiency:98.99 R2: Limit of Detection:0.00009 ng/ul Limit of Quantification:N/A Journal:Scientific Reports Source: https://www.nature.com/articles/s41598-019-41517-2 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
