0 comments Details Genus:Daphnia Species:magna Common Name: Genbank Taxid: Group:Crustacean Habitat:Freshwater/brackish Status:Native Gene Region:N/A Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:TCGGAATGATCTCTCATATTATCAGTC Reverse Primer:ACCTAAGACACCAATAGCTAATATAGC Probe:TCCCAAAGGCTTCCTTCTTCCCTCTTTCG PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Communications Biology Source: https://www.nature.com/articles/s42003-017-0005-3 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.