0 comments Details Genus:Grandidierella Species:japonica Common Name: Genbank Taxid: Group:Crustacean Habitat:Brackish Water Status:native/invasive Gene Region:COI Fragment Length:358 qPCR Chemistry:Dye Forward Primer:CGTTTTAGGTGCTTGGGCCAG Reverse Primer:TGAGTGTGCGATGGTTGCTC Probe:N/A PCR Efficiency:R2 values of the standard curves were 0.986 ∼ 0.995 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Environmental Science & Technology Source: https://pubs.acs.org/doi/abs/10.1021/acs.est.8b04956 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.