African jewelFish 0 comments Details Genus:Hemichromis Species:bimaculatus Common Name:African jewelFish Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status:N/A Gene Region:COI Fragment Length:64 qPCR Chemistry:Probe Forward Primer:CCCTCTAGCAGGCAACCTC Reverse Primer:GTGGAGGGAGAAGATGGCTA Probe:CCACGCCGGACCTTCCGTAGAC PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0103767 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
