chestnut lamprey Details Genus:Ichthyomyzon Species:castaneus Common Name:chestnut lamprey Genbank Taxid: Group:Fish Habitat:freshwater Status:native Gene Region:COI Fragment Length:194 qPCR Chemistry:Conventional PCR Forward Primer:GGCCTTCCCCCGTATAAAT Reverse Primer:ATGAGATTCCAGCGAGGTGT Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:50 copies per reaction Limit of Quantification:N/A Journal:Journal of Great Lakes Research Source: https://doi.org/10.1016/j.jglr.2016.02.017 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast