wavy‐rayed lampmussel 0 comments Details Genus:Lampsilis Species:fasciola Common Name:wavy‐rayed lampmussel Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:Endangered Gene Region:COI Fragment Length:122 qPCR Chemistry:Probe Forward Primer:CTCGGTGGATTTGGCCATT Reverse Primer:GAATCCGCTCAGCAACCAAT Probe:CTGTTGGGAATATACGATCC PCR Efficiency:??? R2: Limit of Detection:between 10 and 100 copies per reaction Limit of Quantification:N/A Journal:Wiley Source: https://onlinelibrary.wiley.com/doi/abs/10.1002/aqc.2869 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
