large white-faced darter 0 comments Details Genus:Leucorrhinia Species:pectoralis Common Name:large white-faced darter Genbank Taxid: Group:Insect Habitat:Freshwater Status:Thretened/Endangered Gene Region:COI Fragment Length:90 qPCR Chemistry:Probe Forward Primer:GCTTTCCCACGATTAAATAA Reverse Primer:TGCACCTCTTTCAACTATACTT Probe:ATAAGATTTTGACTTTTGCCTCC PCR Efficiency:80-100 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Source: https://onlinelibrary-wiley-com.proxy.lib.umich.edu/doi/full/10.1111/j.1365-294X.2011.05418.x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
