golden mussel Details Genus:Limnoperna Species:fortunei Common Name:golden mussel Genbank Taxid: Group:Mollusk Habitat:freshwater Status:invasive Gene Region:COI Fragment Length:N/A qPCR Chemistry:Conventional PCR Forward Primer:TTTAGAGTTAGCACGTCCTGGTAGGTT Reverse Primer:TCCAACCAGTCCCTACTCCACCCTCTA Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Journal of Molluscan Studies Source: https://doi.org/10.1093/mollus/eyi070 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast