Smooth Newt 0 comments Details Genus:Lissotriton Species:vulgaris vulgaris Common Name:Smooth Newt Genbank Taxid: Group:Amphibian Habitat:other Status:Invasive Gene Region:CYTB Fragment Length:99 qPCR Chemistry:Probe Forward Primer:CCTACTTCTCCTACAAAGACATGCT Reverse Primer:TTTCTGGGTCTCCTAAAAGGTTTGG Probe:AAGGAGCATAAGTAAGAAACC PCR Efficiency:98 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Ecological Applications Source: https://esajournals-onlinelibrary-wiley-com.proxy.lib.umich.edu/doi/full/10.1890/14-1751.1 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
