southern brown tree frog Details Genus:Litoria Species:ewingii Common Name:southern brown tree frog Genbank Taxid: Group:Amphibian Habitat:freshwater Status:native Gene Region:ND4 Fragment Length:93 qPCR Chemistry:Probe Forward Primer:CGAGAATACCTTCCCTCTCAC Reverse Primer:GTGTAGGGCCAGCAGAAT Probe:AGTACCAATTCAAACCCGAGAACATGT PCR Efficiency:>95% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Methods in Ecology and Evolution Source: https://doi.org/10.1111/2041-210X.12743 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast