Macquarie perch Details Genus:Macquaria Species:australasica Common Name:Macquarie perch Genbank Taxid: Group:Fish Habitat:Freshwater Status:Endangered Gene Region:ITS-1 Fragment Length:157 qPCR Chemistry:Dye Forward Primer:TAGTTCAATTGCCGTCGTGCA Reverse Primer:CGACGAGGGAGAGAGAGAC Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Methods in Ecology and Evolution Source: https://doi.org/10.1111/2041-210X.12709 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast