largemouth bass Details Genus:Micropterus Species:salmoides Common Name:largemouth bass Genbank Taxid: Group:Fish Habitat:freshwater Status:Fishery Gene Region:ND4 Fragment Length:107 qPCR Chemistry:Probe Forward Primer:AGGCTACGGCATGATACG Reverse Primer:TTGAGCCTGTTATGATTACTCC Probe:GCCCCTTAC/ZEN/CAAGGAACTCA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:North American Journal of Fisheries Management Source: https://doi.org/10.1080/02755947.2017.1342721 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast