opossum shrimp 0 comments Details Genus:Mysis Species:diluviana Common Name:opossum shrimp Genbank Taxid: Group:Crustacean Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:84 qPCR Chemistry:Probe Forward Primer:GAGTTTTAATTCGGTTAGAGTTAGGGC Reverse Primer:CATGCGCAGTAACAATTACGTTATAA Probe:N/A PCR Efficiency:97.1 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0161664 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
