Common mudpuppy Details Genus:Necturus Species:maculosus Common Name:Common mudpuppy Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:114 qPCR Chemistry:Probe Forward Primer:ATGCAGGTGCCTCTGTAGACTTAAC Reverse Primer:TAGAGGGTGGTTTCA TATTGATGGTAGACTTAAC Probe:TTGGCGCAATTAATTAGACTTAAC PCR Efficiency:90.44 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0962-3 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast