round goby 0 comments Details Genus:Neogobius Species:melanostomus Common Name:round goby Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:invasive Gene Region:COI Fragment Length:149 qPCR Chemistry:Probe Forward Primer:CTTCTGGCCTCCTCTGGTGTTG Reverse Primer:CCCTAGAATTGAGGAAATGCCGG Probe:CAGGCAACTTGGCACATGCAG PCR Efficiency:89–101% R2: Limit of Detection:N/A Limit of Quantification:Cq = 38 Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0191720 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
