Striped newt Details Genus:Notophthalmus Species:perstriatus Common Name:Striped newt Genbank Taxid: Group:Amphibian Habitat:freshwater Status:endangered/threatened Gene Region:ND1 Fragment Length:71 qPCR Chemistry:Probe Forward Primer:CCGAGCCCCCTTCGAT Reverse Primer:CTTCCTGCATATTCTACGTTAAATCCT Probe:TAACAGAAGGTGAATCTG PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Journal of Fish and Wildlife Managment Source: http://www.fwspubs.org/doi/abs/10.3996/042014-JFWM-034 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast