Chinook Salmon Details Genus:Oncorlynchus Species:yshawytscha Common Name:Chinook Salmon Genbank Taxid: Group:Fish Habitat:Brackish Status:Threatened Gene Region:CYTB Fragment Length:<150 qPCR Chemistry:Probe Forward Primer:CCTAAAAATCGCTAATGACGCACTA Reverse Primer:GGAGTGAGCCAAAGTTTCATCAG Probe:Probe-AGCACCCTCTAACATTTCAG PCR Efficiency:93.1 R2: Limit of Detection:0.64 pg/μL Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://doi.org/10.1111/1755-0998.12305 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast