Three-lips (Fish) 0 comments Details Genus:Opsariichthys Species:uncirostris uncirostris Common Name:Three-lips (Fish) Genbank Taxid: Group:Fish Habitat:freshwater Status:endangered/threatened Gene Region:D-loop Fragment Length:129 qPCR Chemistry:Probe Forward Primer:CATTTCCTTGCCAGGCTTAATAATA Reverse Primer:GCAAAAGGGGGCATATATATAAGAGA Probe:CATATGTTTATCTCATGTGCATAAC PCR Efficiency:67.2%–82.4% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Ecology and Evolution Source: https://onlinelibrary.wiley.com/doi/full/10.1002/ece3.4653 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
