Signal crayFish 0 comments Details Genus:Pacifastacus Species:leniusculus Common Name:Signal crayFish Genbank Taxid: Group:Crustacean Habitat:freshwater Status:invasive Gene Region:COI Fragment Length:87 qPCR Chemistry:Probe Forward Primer:ATAGTTGAAAGAGGAGTGGGTACT Reverse Primer:TAAATCAACAGAAGCCCCTGCA Probe:CCTCCTCTAGCAGCGGCTATTGCTCATGC PCR Efficiency:N/A R2: Limit of Detection:0.00167pg/μl Limit of Quantification:0.167pg/μl Journal:Management of Biological Invasions Source: https://www.stir.ac.uk/research/hub/publication/877895 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
