lacustrine shrimp Details Genus:Palaemon Species:paucidens Common Name:lacustrine shrimp Genbank Taxid: Group:Crustacean Habitat:Freshwater Status:Native Gene Region:16S Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:AAAGTCTAACCTGCCCACTGAGTTA Reverse Primer:TTTAAGCCTTTTCACTTAAAGGTCA Probe:ATGAGGGAAAAACTG PCR Efficiency:range: 89.3 to 97.4 R2: Limit of Detection:N/A Limit of Quantification:3 copies (per reaction???) Journal:Freshwater Science Source: https://www.journals.uchicago.edu/doi/10.1086/697542 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast