Sea lamprey 0 comments Details Genus:Petromyzon Species:marinus Common Name:Sea lamprey Genbank Taxid: Group:Fish Habitat:Marine Status:Invasive Gene Region:ND4 Fragment Length:122 qPCR Chemistry:Probe Forward Primer:AACACACCTTGATCTGAAACCT Reverse Primer:AGCCTGCGATGGGAGCCT Probe:AATCGCCTG/ZEN/TTTCCTGGCCTTTT PCR Efficiency:93.5-111.5 R2: Limit of Detection:1.5798 copies/reaction Limit of Quantification:10 copies/reaction Journal:Management of Biological Invasions Source: https://www.reabic.net/journals/mbi/2018/Issue4.aspx Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
