North African python Details Genus:Python Species:sebae Common Name:North African python Genbank Taxid: Group:Reptile Habitat:freshwater Status:invasive Gene Region:CYTB Fragment Length:67 qPCR Chemistry:Probe Forward Primer:AATCACCAACCTACTCACTGCTGTAC Reverse Primer:GCCTCCCCATAATCAGGTTGT Probe:CTACCTAGGAACAACTCT PCR Efficiency:92.85 R2: Limit of Detection:1 X 10−4 ng/μL Limit of Quantification:N/A Journal:PLOS One Source: http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0121655 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast