mapleleaf Details Genus:Quadrula Species:quadrula Common Name:mapleleaf Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:Threatened Gene Region:COI Fragment Length:99 qPCR Chemistry:Probe Forward Primer:AGCGGATTCCTTTGTTTGTATGA Reverse Primer:CCGTAAGTAGCATCGTGATAGCA Probe:TTGCGGCGTTACCTGT PCR Efficiency:97 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Aquatic Conservation: Marine and Freshwater Ecosystems Source: https://doi.org/10.1002/aqc.2869 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast
