Northern red-legged frog Details Genus:Rana Species:aurora Common Name:Northern red-legged frog Genbank Taxid: Group:Amphibian Habitat:freshwater Status:native Gene Region:CYTB Fragment Length:85 qPCR Chemistry:Probe Forward Primer:CGGCTGACTCCTCCGTAATTTA Reverse Primer:ATAGAGGCCACGTCCGATGT Probe:ATGCTAACGGCGCATC PCR Efficiency:95–109% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Northwestern Naturalist Source: http://www.bioone.org/doi/abs/10.1898/NWN17-17.1 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast