bull trout Details Genus:Salvelinus Species:confluentus Common Name:bull trout Genbank Taxid: Group:Fish Habitat:Freshwater Status:Threatened Gene Region:CYTB Fragment Length:172 qPCR Chemistry:Probe Forward Primer:TTCCTTTTGCCTAGGGTAGCG Reverse Primer:CGATACTCAACACGCTTCACAATT Probe:FAM-CCACGGCCACACGG-MGBNFQ PCR Efficiency:N/A R2: Limit of Detection:10 ITSI copies per reaction. Limit of Quantification:N/A Journal:PLOS One Source: https://doi.org/10.1371/journal.pone.0206851 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast