Whitespotted char 0 comments Details Genus:Salvelinus Species:leucomaenis Common Name:Whitespotted char Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:endangered/threatened Gene Region:CYTB Fragment Length:126 qPCR Chemistry:Probe Forward Primer:CCCAGCAGGGATCAACTCAG Reverse Primer:GGGTTGGCTGGCGTGA Probe:CCTAACAGCCCTAGCTC PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:The Ecological Society of Japan Source: https://esj-journals.onlinelibrary.wiley.com/doi/full/10.1111/1440-1703.1018 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
