0 comments Details Genus:Schistosoma Species:mansoni Common Name: Genbank Taxid: Group:parasite Habitat:other Status:Parasite Gene Region:COI Fragment Length:162 qPCR Chemistry:Probe Forward Primer:CAGGGGTTTCAAGTCTAATTGGAT Reverse Primer:CAAATAATAACATCGTTATTCCTCTGG Probe:TTCAAATGTTCGATAATA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:International Journal of Infectious Diseases Source: https://www.sciencedirect.com/science/article/pii/S1201971218345077 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.