potomac stygobromid 0 comments Details Genus:Stygobromus Species:tenuis potomacus Common Name:potomac stygobromid Genbank Taxid: Group:Crustacean Habitat:freshwater Status:endangered/threatened Gene Region:COI Fragment Length:154 qPCR Chemistry:Probe Forward Primer:CTGAACAGTATATCCACCACT Reverse Primer:CATTCCAGGTCTCCGTATATTA Probe:TGCAGTAGCCCATAGTGGAGCATCT PCR Efficiency:N/A R2: Limit of Detection:8.4×10−4 ng/μL Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0785-2 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
