Tetracapsuloides bryosalmonae 0 comments Details Genus:Tetracapsuloides Species:bryosalmonae Common Name:Tetracapsuloides bryosalmonae Genbank Taxid: Group:cnidaria Habitat: Status: Gene Region:18S Fragment Length:170 qPCR Chemistry:Probe Forward Primer:CGAACGAGACTTCTTCCTT Reverse Primer:CTTCCTACGCTTTTAAATAGCG Probe:CCCTTCAATTAGTTGATCTAAACCCCAATT PCR Efficiency:97.76 R2: Limit of Detection:7 DNA copies Limit of Quantification:100 DNA copies Journal:Conservation Genetics Resourses Source: https://link.springer.com/article/10.1007%2Fs12686-017-0812-3 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
