great crested newt Details Genus:Triturus Species:cristatus Common Name:great crested newt Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Threatened Gene Region:COI Fragment Length:81 qPCR Chemistry:Probe Forward Primer:CGTAAACTACGGCTGACTAGTACGAA Reverse Primer:CCGATGTGTATGTAGATGCAAACA Probe:CATCCACGCTAACGGAGCCTCGC PCR Efficiency:85.5 R2: Limit of Detection:10−7ngμL−1 Limit of Quantification:10−5ngμL−1 Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0183371 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast