great crested newt Details Genus:Triturus Species:cristatus Common Name:great crested newt Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Thretened/Endangered Gene Region:CYTB Fragment Length:81 qPCR Chemistry:Probe Forward Primer:CGTAAACTACGGCTGACTAGTACGAA Reverse Primer:CCGATGTGTATGTAGATGCAAACA Probe:CATCCACGCTAACGGAGCCTCGC PCR Efficiency:80-100 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Source: https://onlinelibrary-wiley-com.proxy.lib.umich.edu/doi/full/10.1111/j.1365-294X.2011.05418.x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast