0 comments Details Genus:Aedes Species:koreicus Common Name: Genbank Taxid: Group:Insect Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:77 qPCR Chemistry:Probe Forward Primer:CCCAGATATAGCCTTCCCCCG Reverse Primer:GGATAAACAGTTCAT CCTGTCCCAG Probe:CTCCCTCATTAACTCTACTACTTTCAAGAAGTATAGTAG PCR Efficiency:97.5 R2: Limit of Detection:14.87 fg/ul Limit of Quantification:43.97 fg/ul Journal:PLOS one Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5023106/ Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
