Details Genus:Faxonius Species:eupunctus Common Name: Genbank Taxid: Group:Crustacean Habitat:Freshwater Status:Thretened/Endangered Gene Region:COI Fragment Length:124 qPCR Chemistry:Dye Forward Primer:GGAGTTGGGACAGGCTGAACAG Reverse Primer:ACT GAA CCA AGA ATA GAA GAA ACCGTTGGGACAGGCTGAACAG Probe:Not used-qPCR chemistryGTTGGGACAGGCTGAACAG PCR Efficiency:not listed R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Freshwater Biology Source: https://onlinelibrary.wiley.com/doi/abs/10.1111/fwb.13081 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast