0 comments Details Genus:Grandidierella Species:japonica Common Name: Genbank Taxid: Group:Crustacean Habitat:Brackish Water Status:native/invasive Gene Region:COI Fragment Length:126 qPCR Chemistry:Dye Forward Primer:GTTTTAGGTGCTTGGGCCAG Reverse Primer:AGCATGCGCTGTTACTGAGA Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:1 copy/reaction Journal:Environmental Science & Technology Source: https://pubs.acs.org/doi/abs/10.1021/acs.est.8b04956 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.