0 comments Details Genus:Gyrodactylus Species:salaris Common Name: Genbank Taxid: Group:parasite Habitat:other Status:Parasite Gene Region:ITS Fragment Length: qPCR Chemistry:Probe Forward Primer:GGTGGTGGCGCACCTATTC Reverse Primer:ACGATCGTCACTCGGAATCGAT Probe:CAAGCAGAACTGGTTAAT PCR Efficiency:100 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Parasites & Vectors Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5987472 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
