Amami Oshima Frog 0 comments Details Genus:Odorrana Species:splendida Common Name:Amami Oshima Frog Genbank Taxid: Group:Amphibian Habitat:freshwater Status:native Gene Region:CYTB Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:GCTGAGAAGGCGTTGGAATAA Reverse Primer:TGTAGAGGACGGCTTGTAATGC Probe:CCGAAGCGACGCTGCCACC PCR Efficiency:86.7%-112.90% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Royal Society Open Science Source: https://royalsocietypublishing.org/doi/10.1098/rsos.181798 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.