American signal crayfish, 0 comments Details Genus:Pacifastacus Species:leniusculus Common Name:American signal crayfish, Genbank Taxid: Group:Arthropod Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:88 qPCR Chemistry:Probe Forward Primer:GGAATAGTTGAAAGAGGAGTGGG Reverse Primer:ATCAACAGAAGCCCCTGC Probe:(5′-6-FAM-CTGGATGAACTGTTTATCCTCCTCTAGCA-BHQ1-3′) PCR Efficiency:N/A R2: Limit of Detection:10−7 ng/μl Limit of Quantification:10−3 ng/μl Journal:Wiley Source: https://doi.org/10.1002/ece3.3316 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
