Amur Three-Lips 0 comments Details Genus:Opsariichthys Species:uncirostris uncirostris Common Name:Amur Three-Lips Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:D-loop Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:CATTTCCTTGCCAGGCTTAATAATA Reverse Primer:GCAAAAGGGGGCATATATATAAGAGA Probe:5'-FAM-CATATGTTTATCTCATGTGCATAAC-TAMRA-3' PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Ecological Research Source: https://link-springer-com.proxy.lib.umich.edu/article/10.1007%2Fs11284-018-1612-2 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
